The following is part of a BLAST output file. I created it by entering a few lines of the sample.dna file from Chapter 8 into the BLAST program at the NCBI web site, without changing any of the default parameters. I then saved the output as text in the file blst.txt, which is available from this book's web site. I've used it repeatedly in the parsing routines throughout this chapter. Because the output is several pages long, I've truncated it here to show the beginning, the middle, and the end of the file.
BLASTN 2.1.3 [Apr-11-2001] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. RID: 991533563-27495-9092 Query= (400 letters) Database: nt 868,831 sequences; 3,298,558,333 total letters Score E Sequences producing significant alignments: (bits) Value dbj|AB031069.1|AB031069 Homo sapiens PCCX1 mRNA for protein cont... 793 0.0 ref|NM_014593.1| Homo sapiens CpG binding protein (CGBP), mRNA 779 0.0 gb|AF149758.1|AF149758 Homo sapiens CpG binding protein (CGBP) m... 779 0.0 ref|XM_008699.3| Homo sapiens CpG binding protein (CGBP), mRNA 765 0.0 emb|AL136862.1|HSM801830 Homo sapiens mRNA; cDNA DKFZp434F174 (f... 450 e-124 emb|AJ132339.1|HSA132339 Homo sapiens CpG island sequence, subcl... 446 e-123 emb|AJ236590.1|HSA236590 Homo sapiens chromosome 18 CpG island D... 406 e-111 dbj|AK010337.1|AK010337 Mus musculus ES cells cDNA, RIKEN full-l... 234 3e-59 dbj|AK017941.1|AK017941 Mus musculus adult male thymus cDNA, RIK... 210 5e-52 gb|AC009750.7|AC009750 Drosophila melanogaster, chromosome 2L, r... 46 0.017 gb|AE003580.2|AE003580 Drosophila melanogaster genomic scaffold ... 46 0.017 ref|NC_001905.1| Leishmania major chromosome 1, complete sequence 40 1.0 gb|AE001274.1|AE001274 Leishmania major chromosome 1, complete s... 40 1.0 gb|AC008299.5|AC008299 Drosophila melanogaster, chromosome 3R, r... 38 4.1 gb|AC018662.3|AC018662 Human Chromosome 7 clone RP11-339C9, comp... 38 4.1 gb|AE003774.2|AE003774 Drosophila melanogaster genomic scaffold ... 38 4.1 gb|AC008039.1|AC008039 Homo sapiens clone SCb-391H5 from 7q31, c... 38 4.1 gb|AC005315.2|AC005315 Arabidopsis thaliana chromosome II sectio... 38 4.1 emb|AL353748.13|AL353748 Human DNA sequence from clone RP11-317B... 38 4.1 ALIGNMENTS >dbj|AB031069.1|AB031069 Homo sapiens PCCX1 mRNA for protein containing CXXC domain 1, complete cds Length = 2487 Score = 793 bits (400), Expect = 0.0 Identities = 400/400 (100%) Strand = Plus / Plus Query: 1 agatggcggcgctgaggggtcttgggggctctaggccggccacctactggtttgcagcgg 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1 agatggcggcgctgaggggtcttgggggctctaggccggccacctactggtttgcagcgg 60 Query: 61 agacgacgcatggggcctgcgcaataggagtacgctgcctgggaggcgtgactagaagcg 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 61 agacgacgcatggggcctgcgcaataggagtacgctgcctgggaggcgtgactagaagcg 120 Query: 121 gaagtagttgtgggcgcctttgcaaccgcctgggacgccgccgagtggtctgtgcaggtt 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 121 gaagtagttgtgggcgcctttgcaaccgcctgggacgccgccgagtggtctgtgcaggtt 180 Query: 181 cgcgggtcgctggcgggggtcgtgagggagtgcgccgggagcggagatatggagggagat 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 181 cgcgggtcgctggcgggggtcgtgagggagtgcgccgggagcggagatatggagggagat 240 Query: 241 ggttcagacccagagcctccagatgccggggaggacagcaagtccgagaatggggagaat 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 241 ggttcagacccagagcctccagatgccggggaggacagcaagtccgagaatggggagaat 300 Query: 301 gcgcccatctactgcatctgccgcaaaccggacatcaactgcttcatgatcgggtgtgac 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 301 gcgcccatctactgcatctgccgcaaaccggacatcaactgcttcatgatcgggtgtgac 360 Query: 361 aactgcaatgagtggttccatggggactgcatccggatca 400 |||||||||||||||||||||||||||||||||||||||| Sbjct: 361 aactgcaatgagtggttccatggggactgcatccggatca 400 >ref|NM_014593.1| Homo sapiens CpG binding protein (CGBP), mRNA ... (file truncated here) >dbj|AK010337.1|AK010337 Mus musculus ES cells cDNA, RIKEN full-length enriched library, clone:2410002I16, full insert sequence Length = 2538 Score = 234 bits (118), Expect = 3e-59 Identities = 166/182 (91%) Strand = Plus / Plus Query: 219 gagcggagatatggagggagatggttcagacccagagcctccagatgccggggaggacag 278 ||||||||||||||| |||||||| ||||||| || ||||| ||||||||||| ||||| Sbjct: 260 gagcggagatatggaaggagatggctcagacctggaacctccggatgccggggacgacag 319 Query: 279 caagtccgagaatggggagaatgcgcccatctactgcatctgccgcaaaccggacatcaa 338 |||||| |||||||||||||| || ||||||||||||||||| ||||||||||||||||| Sbjct: 320 caagtctgagaatggggagaacgctcccatctactgcatctgtcgcaaaccggacatcaa 379 Query: 339 ctgcttcatgatcgggtgtgacaactgcaatgagtggttccatggggactgcatccggat 398 ||||||||||| || |||||||||||||| |||||||||||||| |||||||||||||| Sbjct: 380 ttgcttcatgattggatgtgacaactgcaacgagtggttccatggagactgcatccggat 439 Query: 399 ca 400 || Sbjct: 440 ca 441 Score = 44.1 bits (22), Expect = 0.066 Identities = 25/26 (96%) Strand = Plus / Plus Query: 118 gcggaagtagttgtgggcgcctttgc 143 ||||||||||||| |||||||||||| Sbjct: 147 gcggaagtagttgcgggcgcctttgc 172 >dbj|AK017941.1|AK017941 Mus musculus adult male thymus cDNA, RIKEN full-length enriched library, clone:5830420C16, full insert sequence Length = 1461 Score = 210 bits (106), Expect = 5e-52 Identities = 151/166 (90%) Strand = Plus / Plus Query: 235 ggagatggttcagacccagagcctccagatgccggggaggacagcaagtccgagaatggg 294 |||||||| ||||||| || ||||| ||||||||||| ||||||||||| ||||||||| Sbjct: 1048 ggagatggctcagacctggaacctccggatgccggggacgacagcaagtctgagaatggg 1107 Query: 295 gagaatgcgcccatctactgcatctgccgcaaaccggacatcaactgcttcatgatcggg 354 ||||| || ||||||||||||||||| ||||||||||||||||| ||||||||||| || Sbjct: 1108 gagaacgctcccatctactgcatctgtcgcaaaccggacatcaattgcttcatgattgga 1167 Query: 355 tgtgacaactgcaatgagtggttccatggggactgcatccggatca 400 |||||||||||||| |||||||||||||| |||||||||||||||| Sbjct: 1168 tgtgacaactgcaacgagtggttccatggagactgcatccggatca 1213 Score = 44.1 bits (22), Expect = 0.066 Identities = 25/26 (96%) Strand = Plus / Plus Query: 118 gcggaagtagttgtgggcgcctttgc 143 ||||||||||||| |||||||||||| Sbjct: 235 gcggaagtagttgcgggcgcctttgc 260 >gb|AC009750.7|AC009750 Drosophila melanogaster, chromosome 2L, region 23F-24A, BAC clone ... (file truncated here) >emb|AL353748.13|AL353748 Human DNA sequence from clone RP11-317B17 on chromosome 9, complete sequence [Homo sapiens] Length = 179155 Score = 38.2 bits (19), Expect = 4.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 192 ggcgggggtcgtgagggagtgcg 214 |||| |||||||||||||||||| Sbjct: 48258 ggcgtgggtcgtgagggagtgcg 48280 Database: nt Posted date: May 30, 2001 3:54 AM Number of letters in database: -996,408,959 Number of sequences in database: 868,831 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 436021 Number of Sequences: 868831 Number of extensions: 436021 Number of successful extensions: 7536 Number of sequences better than 10.0: 19 length of query: 400 length of database: 3,298,558,333 effective HSP length: 20 effective length of query: 380 effective length of database: 3,281,181,713 effective search space: 1246849050940 effective search space used: 1246849050940 T: 0 A: 30 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)
As you can see, the file consists of three parts: some header information at the beginning followed by a summary of the alignments, the alignments, and then some additional summary parameters and statistics at the end.